View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4497_high_5 (Length: 274)
Name: NF4497_high_5
Description: NF4497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4497_high_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 19 - 271
Target Start/End: Original strand, 35890032 - 35890287
Alignment:
| Q |
19 |
gcttttggctttgcggcagctttcggcttcacagc---agctttcgcctttggcttagttgcagccttagcggctggcttggtaacagccttagccttct |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35890032 |
gcttttggctttgcggcagctttcggcttcacagcagcagctttcgcctttggcttagttgcagccttagcggctggcttggtaacagccttagccttct |
35890131 |
T |
|
| Q |
116 |
tagcaggagcaatagcggccttcaccggagcagttttggccacagctggggcgattttgaaggagtttttcaccttgacgagctttccagaagccacaga |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
35890132 |
tagcaggagcaatagcggccttcaccggagcagttttggccacagctggggcgattttgaaggagtttttcaccttcacaagctttccagaagccacaga |
35890231 |
T |
|
| Q |
216 |
tttcttcagatgaagaagaatgagtttgcggaatgttggagataaatccctatgct |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35890232 |
tttcttcagatgaagaagaatgagtttgcggaatgttggagataaatccttatgct |
35890287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University