View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4497_low_14 (Length: 210)
Name: NF4497_low_14
Description: NF4497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4497_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 20 - 194
Target Start/End: Complemental strand, 31611500 - 31611324
Alignment:
| Q |
20 |
aaagagcaatctccgtttgtgtatgc--tatatattgaattgtatctaatgtgatgtgcttattgcctaatatcaaatttcagtcaaatcctagtcgcat |
117 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
31611500 |
aaagagcaatctccgtttgtgattggggtatatattgaattgtatctaatgtgatgtgcttattgcctaatatcaaatttcagtcaaaccctagtcgcat |
31611401 |
T |
|
| Q |
118 |
caacatttgttgggttgtactactactcatttcttaatgtcaatatcatatgtatctcaaccacttcttttgttctt |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31611400 |
caacatttgttgggttgtactactactcatttcttaatgccaatatcatatgtatctcaaccacttcttttgttctt |
31611324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University