View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4497_low_15 (Length: 204)
Name: NF4497_low_15
Description: NF4497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4497_low_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 4 - 189
Target Start/End: Original strand, 40898669 - 40898849
Alignment:
| Q |
4 |
gacgttcgacgagctttgcgtttgttaaagacaaacgagctttatatctcttacgtattacaatttgggttcatcattatcattgactttttccagtagt |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40898669 |
gacgttcgacgagctttgcgtttgttaaagacaaacgagctttatatctctta----ttacaatttgggttcat---tatcattgactttttccagtagt |
40898761 |
T |
|
| Q |
104 |
gtcagggtgagccgggaaggatttgatgaattcgtgaagtatgtctatgtcatt--attggctttcatattcgtatcaacaggtatgt |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| | | | |||||||||||||||||||||||| |
|
|
| T |
40898762 |
gtcagggtgagccgggaaggatttgatgaattcgtgaagtatgtctatgtcattggctatgatatcatattcgtatcaacaggtatgt |
40898849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University