View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4497_low_5 (Length: 325)
Name: NF4497_low_5
Description: NF4497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4497_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 17 - 230
Target Start/End: Complemental strand, 46810887 - 46810672
Alignment:
| Q |
17 |
agatcggacactaggcactggtacccaacatcttgaaatagtagttggaaatagtttatgaacacacaattatgttgagttattcattctcacataatga |
116 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
46810887 |
agatcggacactaggtactggtacccaacatcttgaaatagtagttggaaatagtttatgaacacacaattatgctgagttattcattctcacataatga |
46810788 |
T |
 |
| Q |
117 |
aacacaaaac--ttttattcatagcagaaagtggagctcaagttattatagttactagagcctgcatgtacattcttcactcattatgagttacctagct |
214 |
Q |
| |
|
||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
46810787 |
aacacaagacttttttattcatagcagaaagtggagctcaagttattatagttactagagcctgcatgtacattcttcactcattatgagatacctagct |
46810688 |
T |
 |
| Q |
215 |
cttacatcttacatgc |
230 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
46810687 |
cttacatcttacatgc |
46810672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 264 - 310
Target Start/End: Complemental strand, 46810641 - 46810595
Alignment:
| Q |
264 |
ctcagtacaaagtgctcaaaattgataacagaggaccctttcttttc |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46810641 |
ctcagtacaaagtgctcaaaattgataacagaggaccctttcttttc |
46810595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University