View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4498_high_10 (Length: 287)

Name: NF4498_high_10
Description: NF4498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4498_high_10
NF4498_high_10
[»] chr7 (1 HSPs)
chr7 (9-271)||(12026528-12026790)
[»] scaffold0504 (1 HSPs)
scaffold0504 (43-82)||(7747-7786)


Alignment Details
Target: chr7 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 9 - 271
Target Start/End: Complemental strand, 12026790 - 12026528
Alignment:
9 gataattcttgcaaagatattccaatggacaaaaactctgtcccagagaaaaatgctgtgaatgacgatgattttttgcttttgtgcagagaaattgata 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
12026790 gataattcttgcaaagatattccaatggacaaaaactctgtcccagagaaaaatgctgtgaatgacgatgattttttgcttttttgcagagaaattgata 12026691  T
109 gattttcaagttatcaggctggagaaggttctggatatgttaatggggacaacaggtcaagtgtcgaggttggagaagtttctgatttgcgccacggtcc 208  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
12026690 gattttcaagttatcaggttggagaaggttctggatatgttaatggggacaacaggtcaagtgtcgaggttggagaagtttctgatttgcgccaaggtcc 12026591  T
209 ggtgctggatttgctgccagactcaatccgcagtcgttttgagaaagtagttgcaggtgtatc 271  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
12026590 ggtgctggatttgctgccagactcaatccgcagtcgtttggagaaagtagttgcaggtgtatc 12026528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0504 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0504
Description:

Target: scaffold0504; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 43 - 82
Target Start/End: Original strand, 7747 - 7786
Alignment:
43 actctgtcccagagaaaaatgctgtgaatgacgatgattt 82  Q
    |||||||||||||||||||||||||||| |||| ||||||    
7747 actctgtcccagagaaaaatgctgtgaacgacgttgattt 7786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University