View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4498_high_10 (Length: 287)
Name: NF4498_high_10
Description: NF4498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4498_high_10 |
 |  |
|
| [»] scaffold0504 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 9 - 271
Target Start/End: Complemental strand, 12026790 - 12026528
Alignment:
| Q |
9 |
gataattcttgcaaagatattccaatggacaaaaactctgtcccagagaaaaatgctgtgaatgacgatgattttttgcttttgtgcagagaaattgata |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
12026790 |
gataattcttgcaaagatattccaatggacaaaaactctgtcccagagaaaaatgctgtgaatgacgatgattttttgcttttttgcagagaaattgata |
12026691 |
T |
 |
| Q |
109 |
gattttcaagttatcaggctggagaaggttctggatatgttaatggggacaacaggtcaagtgtcgaggttggagaagtttctgatttgcgccacggtcc |
208 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
12026690 |
gattttcaagttatcaggttggagaaggttctggatatgttaatggggacaacaggtcaagtgtcgaggttggagaagtttctgatttgcgccaaggtcc |
12026591 |
T |
 |
| Q |
209 |
ggtgctggatttgctgccagactcaatccgcagtcgttttgagaaagtagttgcaggtgtatc |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12026590 |
ggtgctggatttgctgccagactcaatccgcagtcgtttggagaaagtagttgcaggtgtatc |
12026528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0504 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0504
Description:
Target: scaffold0504; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 43 - 82
Target Start/End: Original strand, 7747 - 7786
Alignment:
| Q |
43 |
actctgtcccagagaaaaatgctgtgaatgacgatgattt |
82 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
7747 |
actctgtcccagagaaaaatgctgtgaacgacgttgattt |
7786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University