View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4498_high_16 (Length: 250)
Name: NF4498_high_16
Description: NF4498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4498_high_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 186 - 239
Target Start/End: Complemental strand, 1223981 - 1223928
Alignment:
| Q |
186 |
acttgatttttacaattaaatttagggttaatatatgtttgtcccctccagtat |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
1223981 |
acttgatttttacaattaaatttagggttaatatatgtttgtctcctgcagtat |
1223928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 114 - 162
Target Start/End: Complemental strand, 36893604 - 36893556
Alignment:
| Q |
114 |
cttttgagtagaattcattttgttttcataattgattatactttaagtt |
162 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||| ||| ||||| ||||| |
|
|
| T |
36893604 |
cttttgagtagaatttattttgtcttcataattaattctacttaaagtt |
36893556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University