View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4498_low_14 (Length: 259)
Name: NF4498_low_14
Description: NF4498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4498_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 29 - 251
Target Start/End: Complemental strand, 36808541 - 36808321
Alignment:
| Q |
29 |
ttgcaattcaattttgttcactcctagcagttagatagatgcgtacacttaggttgtgagacttctccttatatatttgaatttgagcctcaagcttcct |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36808541 |
ttgcaattcaattttgttcactcctagcagttagatagatgcgtacacttaggttgtgagacttctccttatatatttgaatttgagcctt--gcttcct |
36808444 |
T |
|
| Q |
129 |
atatgcctcattcttatactcaaaattaccacatttgccgtaataaggaaagtcggaatcgtcatgcttagagaagtacgtcacaagatcttcaacgggt |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36808443 |
atatgcctcattcttatactcaaaattaccacgtttgccgtaatatggaaagtcggaatcgtcatgcttagagaagtacgtcacaagatcttcaacgggt |
36808344 |
T |
|
| Q |
229 |
tctgttccattctctgcttctcc |
251 |
Q |
| |
|
|||||||||||||||| |||||| |
|
|
| T |
36808343 |
tctgttccattctctgtttctcc |
36808321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 60 - 203
Target Start/End: Original strand, 36512295 - 36512438
Alignment:
| Q |
60 |
tagatagatgcgtacacttaggttgtgagacttctccttatatatttgaatttgagcctcaagcttcctatatgcctcattcttatactcaaaattacca |
159 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
36512295 |
tagatagatgcgtacacttaggttgcgagacttctccttatagatttgaatttgagcctcaagcagcctatatgcctcattcttatactcaaaattacca |
36512394 |
T |
|
| Q |
160 |
catttgccgtaataaggaaagtcggaatcgtcatgcttagagaa |
203 |
Q |
| |
|
| |||| ||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
36512395 |
cttttgacgtgataaggaaagtcggaatcgtcatacttagagaa |
36512438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University