View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4498_low_15 (Length: 250)
Name: NF4498_low_15
Description: NF4498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4498_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 46910961 - 46911205
Alignment:
| Q |
1 |
tgaactatagcactacctcatcaccagaaatttctttatgtataaaataaataaattatatcgacacctgcatttgcaatatcactcattttttatataa |
100 |
Q |
| |
|
||||||||| ||||| |||||||||| |||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46910961 |
tgaactatatcactaactcatcaccataaatttctttatctacaaaataaataaattatatcgacacctgcatttgcaatatcactcattttttatataa |
46911060 |
T |
|
| Q |
101 |
annnnnnnagagtaaaaggatagtttgctatattactctttcctcttaataaaataccacatgcatttcacaatatccaacaatgcaatttttatataga |
200 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| || |
|
|
| T |
46911061 |
atttttttagagtaaaaggatagtttgctatattactctttcctcttaataaaataccacatgcatttcgcaatatccaacaatgcaatttttatatgga |
46911160 |
T |
|
| Q |
201 |
aaaatattttatctcatacttctctaacaaaatgacctttgctac |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
46911161 |
aaaatattttatctcatacttctctaacaaaatgaccttttctac |
46911205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University