View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4498_low_16 (Length: 250)

Name: NF4498_low_16
Description: NF4498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4498_low_16
NF4498_low_16
[»] chr8 (1 HSPs)
chr8 (186-239)||(1223928-1223981)
[»] chr2 (1 HSPs)
chr2 (114-162)||(36893556-36893604)


Alignment Details
Target: chr8 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 186 - 239
Target Start/End: Complemental strand, 1223981 - 1223928
Alignment:
186 acttgatttttacaattaaatttagggttaatatatgtttgtcccctccagtat 239  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||| ||||||    
1223981 acttgatttttacaattaaatttagggttaatatatgtttgtctcctgcagtat 1223928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 114 - 162
Target Start/End: Complemental strand, 36893604 - 36893556
Alignment:
114 cttttgagtagaattcattttgttttcataattgattatactttaagtt 162  Q
    ||||||||||||||| ||||||| ||||||||| ||| ||||| |||||    
36893604 cttttgagtagaatttattttgtcttcataattaattctacttaaagtt 36893556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University