View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4498_low_17 (Length: 240)
Name: NF4498_low_17
Description: NF4498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4498_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 46910807 - 46910586
Alignment:
| Q |
1 |
tacaaaggtatttggatttacctcactctaagaacactagttgtgttcaaaccaaagatctctaaattttgacgtcnnnnnnnnnaccactagatcaaac |
100 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
46910807 |
tacaaaggcatttgaatttacctcactctaagaacactagttgtgttcgaaccaaagatctctaaaatttgacgtctctctttttaccactagatcaaac |
46910708 |
T |
 |
| Q |
101 |
ttttggaattatcaatacaaaatttattttgtatttgctttgcgcctgtagaagcttatactacacatatgaagacaaaaggnnnnnnnttcttcattat |
200 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
46910707 |
ttttagaattatcaatacaaaatttattttgtatttgctttgcgcctgtagaagcttatactacacatatgaagacaaaaggaaaaaaattcttcattat |
46910608 |
T |
 |
| Q |
201 |
taatccttcctaataaacaata |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
46910607 |
taatccttcctaataaacaata |
46910586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University