View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4498_low_3 (Length: 491)
Name: NF4498_low_3
Description: NF4498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4498_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 2e-72; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 2e-72
Query Start/End: Original strand, 287 - 478
Target Start/End: Complemental strand, 13021737 - 13021547
Alignment:
| Q |
287 |
tgcaaaaattacttcatttgactctataatcaaatgcagtaatacaaaatgaatgcaattggaaagtgtcattcaaacttgtatcattaatgcaatgtaa |
386 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13021737 |
tgcaaaaattacttcatttgactctataatcaa-tgcagtaatacaaaatgaatgcaattggaaagtgtcattcaaacttgtatcattaatgcaatgtaa |
13021639 |
T |
 |
| Q |
387 |
agcggaaacaaatattaaaacttttnnnnnnntaaacagtcgttaattaaatctgcatcataaatgtctatatactagaatagaaatcccaa |
478 |
Q |
| |
|
||||||| |||||||| ||| |||| ||||||||||||| || |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13021638 |
agcggaagcaaatattcaaatttttaaaacaataaacagtcgttatctacatctgcatcataaatgtctatatactagaatagaaatcccaa |
13021547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 190 - 233
Target Start/End: Original strand, 35556397 - 35556440
Alignment:
| Q |
190 |
catggtaacaaatattctaaaaatattgtttaaggaatctatta |
233 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
35556397 |
catgttaacaaatgttctaaaaatattgtttaaggaatttatta |
35556440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University