View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4498_low_8 (Length: 328)
Name: NF4498_low_8
Description: NF4498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4498_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 11 - 239
Target Start/End: Original strand, 43736799 - 43737028
Alignment:
| Q |
11 |
cacagacacaaaaaccaatcaaaagaaatagaattttca-cttattttgaaagaactgatgaaatagctgtgatcacttagacatgaattgagttgaagg |
109 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43736799 |
cacaaacacaaaaaccaatcaaaagaaatagaattttcaacttattttgaaagaactgatgaaatagctgtgatcacttagacatgaattgagttgaagg |
43736898 |
T |
 |
| Q |
110 |
aggattgttcaatgttggatcactttgctgttttgaatgctgcagtgcaagaattccattccaccctgcactcacattttttgttatagttgtcaatttt |
209 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43736899 |
aggattgttcaatgttggatcactttgatgttttgaatgctgtagtgcaagaattccattccaccctgcactcacattttttgttatagttgtcaattta |
43736998 |
T |
 |
| Q |
210 |
cagtcactttataaatgaacatctttattt |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
43736999 |
cagtcactttataaatgaacatctttattt |
43737028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University