View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4498_low_9 (Length: 292)
Name: NF4498_low_9
Description: NF4498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4498_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 21 - 277
Target Start/End: Complemental strand, 53553506 - 53553253
Alignment:
| Q |
21 |
cacagacaaatatggttgttgcgaccacaattatagctgcattgcgattatattaatataaaaaattgttatttcacggtctctccagatcacagtcgca |
120 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||| |||||||||| ||| |
|
|
| T |
53553506 |
cacagataaatatggttgttgcgaccacaattatagctgcattgcgattatatcaatataaaacattgttatttcacggtctctctagatcacagtagca |
53553407 |
T |
|
| Q |
121 |
gaaatttatttaaaatttggatatatttgatagtcatactaactattttcttttgtaaaacgtaaaatgtaaggtgaatgcttcttcttcttcttttttg |
220 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
53553406 |
aaaatttatttaaaatttaggtatatttgatagtcatactaactattttcttttgtaaaacgtaaaatgtaaggtgaatgcttcttct---tcttttttg |
53553310 |
T |
|
| Q |
221 |
tgaggaaggtgaatgcttttgttagtgattcaacatcatagaataatagatatatgt |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
53553309 |
tgaggaaggtgaatgcttttgttagtgattcaacttcatagaataatagatatatgt |
53553253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University