View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4499-Insertion-10 (Length: 427)
Name: NF4499-Insertion-10
Description: NF4499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4499-Insertion-10 |
 | |
|
| [»] chr3 (3 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 9e-74; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 9e-74
Query Start/End: Original strand, 279 - 427
Target Start/End: Complemental strand, 41104970 - 41104822
Alignment:
| Q |
279 |
tccggtgagacgttggacgaggttcatgaagtccccgggtgtggtgtggattaccttaggggagacggtgtagattataattggttggcgcggttgttaa |
378 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
41104970 |
tccggtgagacgttggacgaggttcatgaagtccccgggtgtggtgtggattaccttaggggagacggtgtagattataattggttggcgcggttgttga |
41104871 |
T |
|
| Q |
379 |
tattgttgttgttgttgctgctgctgtggcgccaatggtggtttcttga |
427 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
41104870 |
tattgttgttgttgctgctgctgctgtggcgccaatggtggtttcttga |
41104822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 8 - 116
Target Start/End: Complemental strand, 41105235 - 41105127
Alignment:
| Q |
8 |
gaaacatcatgtttcctctctctactccatgattcatcaattgtgtttgttctatcccttccatgtcacttattacatcactagtaaaacttgttattgg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41105235 |
gaaacatcatgtttcctctctctactccatgattcatcaattgtgtttgttctatcccttccatgtcacttattacatcactagtaaaacttgttattgg |
41105136 |
T |
|
| Q |
108 |
tgctactat |
116 |
Q |
| |
|
||||||||| |
|
|
| T |
41105135 |
tgctactat |
41105127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 146 - 246
Target Start/End: Complemental strand, 41105106 - 41105006
Alignment:
| Q |
146 |
ttttccccaaaggagacatagctttctccatggtggcataacgcgccgcgggggatattgttccatccccgcggaaaggatcaatatttgatgatgaaga |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41105106 |
ttttccccaaaggagacatagctttctccatggtggcataacgcgccgcgggggatattgttccatccccgcggaaaggatcaatatttgatgatgaaga |
41105007 |
T |
|
| Q |
246 |
c |
246 |
Q |
| |
|
| |
|
|
| T |
41105006 |
c |
41105006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University