View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4499-Insertion-15 (Length: 156)
Name: NF4499-Insertion-15
Description: NF4499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4499-Insertion-15 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 139; Significance: 5e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 139; E-Value: 5e-73
Query Start/End: Original strand, 10 - 156
Target Start/End: Complemental strand, 11697487 - 11697342
Alignment:
| Q |
10 |
ttcaactgccattccatttggtgaatcatctcatagattatgttccattgaggtatagacttgtcttgtgaaacaaacttgtacactttcctctttgctt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11697487 |
ttcaactgccattccatttggtgaatcatctcatagattatgttccattgaggtatagacttgtcttgtgaaacaaacttgtacactttcctctttgctt |
11697388 |
T |
 |
| Q |
110 |
caattaaactaagacccgggtgtttgtaccaagtttctttcggctaa |
156 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
11697387 |
caattaaactaa-acccgggtgtttgtaccaagtttctttcggctaa |
11697342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University