View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4499_low_3 (Length: 516)
Name: NF4499_low_3
Description: NF4499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4499_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 394; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 394; E-Value: 0
Query Start/End: Original strand, 18 - 501
Target Start/End: Complemental strand, 40551501 - 40551018
Alignment:
| Q |
18 |
aataaggccttcttaaggtgttagatgtatggaactttgcttgttttcattggggtatgatgcatgaatctttgaataaaagatctgtcagtgtgttttt |
117 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
40551501 |
aataaagccttcttaaggtgttatatgtatggaactttgcttgttttcattggggtatgatgcatgaatctttgaataaaaggtctttcagtgtgttttt |
40551402 |
T |
|
| Q |
118 |
gttatctaatctcatttagagagtgcnnnnnnngggttctcttttgtaattcagattcataattttatgagtggtttaaagtagttatttcattataggc |
217 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
40551401 |
gttatctaatctcatttagagagtgctttttttgggttctcttttgtaattctgattgataattttatgagtggtttaaagtagttatttcattatatgc |
40551302 |
T |
|
| Q |
218 |
atataaagtttcttcaagttttgttatttactagttttttccaggaggataccttgtcctaggtatttgcaatatttannnnnnngctacacatcaatat |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
40551301 |
atataaagtttcttcaagttttgttatttactagttttttccaggaggataccttgtcctaggtatttgcaatatttatttttttgccacacatcaatat |
40551202 |
T |
|
| Q |
318 |
atcatcatatcatagtctgattagtctgatttatcaatgtcagttaatattatagtctcacttgtctgatttaccaatgtcagttaatccattcactagt |
417 |
Q |
| |
|
| |||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40551201 |
aacatcatatcatagtctcattagtctgatttatcaatgtcagttaatatcatagtctcacttgtctgatttaccaatgtcagttaatccattcactagt |
40551102 |
T |
|
| Q |
418 |
actatgagtatttaatccatcataaaatccaaagtaaaacatttttcttttctgcattgtttagagaagttcgtcttgatggct |
501 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40551101 |
actatgagtattcaatccatcataaaatccaaagtaaaacatttttcttttctgcattgtttagagaagttcgtcttgatggct |
40551018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University