View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4499_low_5 (Length: 387)
Name: NF4499_low_5
Description: NF4499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4499_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 19 - 377
Target Start/End: Complemental strand, 43366979 - 43366624
Alignment:
| Q |
19 |
agacaagtccagaagactcatcggactccttcttgccagtttcctccgccgtcgtctcattcaccgcctcctcatttccgccatctccgtctgccttctc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
43366979 |
agacaagtccagaagactcatcggactccttctttccagtttcctccgccgtcgtctcattcatcgcctcctcatttcctccatctccgtctgccttctc |
43366880 |
T |
|
| Q |
119 |
cttcttttcatcatgctctctctcttcgctccttccccttttattgtaaatgctcttcatccttctacttcaattacattcctcattccattctgctgct |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43366879 |
tttcttttcatcatgctctctctcttcgctccttccccttttattgtaaatgctcttcatccttctacttcaattacattcctcattccattttgctgct |
43366780 |
T |
|
| Q |
219 |
gtgtgtaactttgattgtatttcaggataatgatttggttaaatctcgtttagattctcatcagcaatccccatttcacattccggtaatcaaacaatgt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43366779 |
gtgtgtaactttgattgtatttcaggataatgatttggttaaatctcgtttagattctcatcagcaatccccatttcacattccggtaatcaaacaatgt |
43366680 |
T |
|
| Q |
319 |
tctcaccttcnnnnnnnatgcattttttgttatgttgctaatatcttccctttgcttct |
377 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
43366679 |
tctcacctt---tttttattcattttttgttatgttgctaatatcttccttttgtttct |
43366624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University