View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4499_low_7 (Length: 294)
Name: NF4499_low_7
Description: NF4499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4499_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 276
Target Start/End: Complemental strand, 2488292 - 2488006
Alignment:
| Q |
1 |
agaactgtgtggaacatgaactcagtaagaaattaacaaacacgtcgaaaattacttgatgtaaacataagatagaaaaca-----------atgcaatg |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2488292 |
agaactgtgtggaacatgaactcagtaagaaattaacaaacacgtcgaaaattacttgatgtaaacataagatagaaaacatactcaaaacaatgcaatg |
2488193 |
T |
|
| Q |
90 |
taattattaatattgcgtagaattgcagtcaaatgcgactgatgcagtctcaatcgcagtggcgtcgctgtttcagcaacatcaaaaacctttatctcat |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2488192 |
taattattaatattgcgtagaattgcagtcaaatgcgactgatgcagtctcaatcgcagtggcgtcgctgtttcagcaacatcaaaaacctttatctcat |
2488093 |
T |
|
| Q |
190 |
acgaaatttaccttattcgtggttctctagctactgtctgactctcagaccttttatttccagcccattgttgtcttatctggttcc |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2488092 |
acgaaatttaccttattcgtggttctctagctactgtctgtctctcagaccttttatttccagcccattgttgccttatctggttcc |
2488006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University