View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4501-Insertion-10 (Length: 249)
Name: NF4501-Insertion-10
Description: NF4501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4501-Insertion-10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 16 - 137
Target Start/End: Original strand, 13417530 - 13417652
Alignment:
| Q |
16 |
acttcttttgtttcccataattaattttatgttgtccttaaccagagacatacccaaa-tccgttatttcacacttttttatttgcctcatacgcatgac |
114 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||||||||| |||||| |||||| |||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
13417530 |
acttcctttgtttcccataattaattttatgttatccttaaccaaagacatgcccaaaatccgttatttcacacttttttatttgcctcatgcgcatgac |
13417629 |
T |
|
| Q |
115 |
acatgacatgtcctcccttttct |
137 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
13417630 |
acatgacatgtcctcccttttct |
13417652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 163 - 233
Target Start/End: Original strand, 13417678 - 13417750
Alignment:
| Q |
163 |
gtgtaatgttgggctacaagtattgcaaagactaacccaacttaacaaa---aggagtataatgcatatcaaag |
233 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
13417678 |
gtgtaatgttgggctacaagtat-gcaaagactaacccaacttaacaaaaggaggagtgtaatgcatatcaaag |
13417750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University