View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4501-Insertion-12 (Length: 202)
Name: NF4501-Insertion-12
Description: NF4501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4501-Insertion-12 |
 |  |
|
| [»] scaffold0286 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0286 (Bit Score: 164; Significance: 7e-88; HSPs: 1)
Name: scaffold0286
Description:
Target: scaffold0286; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 8 - 183
Target Start/End: Original strand, 13162 - 13337
Alignment:
| Q |
8 |
gtatgtagcttttccctttgtattctgttctattccagagagtgttttttcccgttcaggtttgtttatatctatttacctttagaaaaaacaattcaac |
107 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
13162 |
gtatgtagcttttctctttgtattctgttctattccggagagtgttttttcccgttcaggtttgtatatatctatttacctttagaaaaaacaattcaac |
13261 |
T |
 |
| Q |
108 |
ctgcatctgataatgcatggatatttgttgggtgttaacccctcccattttcagggaagaggctcttgtaattcaa |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13262 |
ctgcatctgataatgcatggatatttgttgggtgttaacccctcccattttcagggaagaggctcttgtaattcaa |
13337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 164; Significance: 7e-88; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 8 - 183
Target Start/End: Complemental strand, 2170100 - 2169925
Alignment:
| Q |
8 |
gtatgtagcttttccctttgtattctgttctattccagagagtgttttttcccgttcaggtttgtttatatctatttacctttagaaaaaacaattcaac |
107 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2170100 |
gtatgtagcttttctctttgtattctgttctattccggagagtgttttttcccgttcaggtttgtatatatctatttacctttagaaaaaacaattcaac |
2170001 |
T |
 |
| Q |
108 |
ctgcatctgataatgcatggatatttgttgggtgttaacccctcccattttcagggaagaggctcttgtaattcaa |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2170000 |
ctgcatctgataatgcatggatatttgttgggtgttaacccctcccattttcagggaagaggctcttgtaattcaa |
2169925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University