View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4501_high_38 (Length: 232)
Name: NF4501_high_38
Description: NF4501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4501_high_38 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 12 - 216
Target Start/End: Original strand, 30818866 - 30819070
Alignment:
| Q |
12 |
gaacctgtggtaactataaggcattatattgtgcatatttatatgacgacaactttgaatcctgcatttcttttaaaaaagaaatttgacttctgcatta |
111 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
30818866 |
gaacttgtggtaactataaggcattatattgtgcatatttatatgacgacaactttgaatcctgcatttcttttaaaaaagaaatttgacttctgcacta |
30818965 |
T |
 |
| Q |
112 |
aatctatattgttcaataacgatccattggctatggaagtaacaattgcgtgagtgcgtttgcaacgatttttaattctataactttgaaacttgtgtgt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30818966 |
aatctatattgttcaataacgatccattggctatggaagtaacaattgcgtgagtgcgtttgcaacgatttttaattctataactttgaaacttgtgtgt |
30819065 |
T |
 |
| Q |
212 |
gtacc |
216 |
Q |
| |
|
||||| |
|
|
| T |
30819066 |
gtacc |
30819070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University