View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4501_low_32 (Length: 278)
Name: NF4501_low_32
Description: NF4501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4501_low_32 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 252; Significance: 1e-140; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 7 - 262
Target Start/End: Original strand, 40113659 - 40113914
Alignment:
| Q |
7 |
gaagcaaagggtcaactgaaaatggaagcagtgaagggttgtcataaggaattagaagcaaaagcacaagtagttgcaaatgatgttgtcacagaaactg |
106 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40113659 |
gaagaaaagggtcaactgaaaatggaagcagtgaagggttgtcataaggaattagaagcaaaagcacaagtagttgcaaatgatgttgtcacagaaactg |
40113758 |
T |
|
| Q |
107 |
aactaaccaaaatccgtcttgtgagagcctttgttgaaacacaagatccatcttctaaggtacttcttatcatacataaccaacgtctataatattacaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40113759 |
aactaaccaaaatccgtcttgtgagagcctttgttgaaacacaagatccatcttctaaggtacttcttatcatacataaccaacgtctataatattacaa |
40113858 |
T |
|
| Q |
207 |
aaaattgcttcatatggtttggtttggtatcctcacctatattcacatgtttcata |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40113859 |
aaaattgcttcatatggtttggtttggtatcctcacctatattcacatgtttcata |
40113914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 81 - 170
Target Start/End: Original strand, 40120994 - 40121083
Alignment:
| Q |
81 |
tgcaaatgatgttgtcacagaaactgaactaaccaaaatccgtcttgtgagagcctttgttgaaacacaagatccatcttctaaggtact |
170 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40120994 |
tgcaaatgatgctgttacagaaactgaactaaccaaaatccgtcttgtgcgaccctttgttgaaacacaagatccatcttctaaggtact |
40121083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University