View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4501_low_37 (Length: 251)
Name: NF4501_low_37
Description: NF4501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4501_low_37 |
 |  |
|
| [»] scaffold0088 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0088 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: scaffold0088
Description:
Target: scaffold0088; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 117 - 240
Target Start/End: Complemental strand, 49037 - 48916
Alignment:
| Q |
117 |
ttcaattggtatgcaagctttcacaattaattagtgttgcgtggagagagcgagagagaaaagataaagaaatataccagtttctctaaatcatcgcgtt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
49037 |
ttcaattggtatgcaagctttcacaattaattagtgttgcgtggagagagcgagaga--aaagataaagaaatataccagtttctctaaatcatggcgtt |
48940 |
T |
 |
| Q |
217 |
ctttttcaaaatctttcatttcat |
240 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
48939 |
ctttttcaaaatctttcatttcat |
48916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0088; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 49 - 120
Target Start/End: Complemental strand, 49151 - 49080
Alignment:
| Q |
49 |
gctagggtttacttgcgagatgcactgtgcggctagggatttactcggatcggtgtagcacactttcattca |
120 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
49151 |
gctagggtttacttgtgagatgcactgtgcggctagggattcactcggatcggtgtagcacactttcattca |
49080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University