View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4501_low_52 (Length: 221)
Name: NF4501_low_52
Description: NF4501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4501_low_52 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 168; Significance: 3e-90; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 17 - 203
Target Start/End: Complemental strand, 6310041 - 6309854
Alignment:
| Q |
17 |
atttgggagcggtgatctcaacgttacacctcacaatgaaatatcctattggagatggaatggtcggagttgtcaaggcagacctcgagatggagaaaaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
6310041 |
atttgggagcggtgatctcaacgttacacctcacaatgaaatatcctattggagatggaatggtcggacttgtcaaggcagacctcgagatggcgaaaaa |
6309942 |
T |
 |
| Q |
117 |
gtgttatgagatgtgccctacggctatttaggtgtttctttcaattttcaacaac-taagaaaaactgtcttatatatgttaggagta |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
6309941 |
gtgttatgagatgtgccctacggctatttaggtgtttctttcaattttcaacaacttaagaaaaaatgtcttatatatgttaggagta |
6309854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 28 - 166
Target Start/End: Complemental strand, 6323707 - 6323564
Alignment:
| Q |
28 |
gtgatctcaacgttacacctcacaatgaaatatcctattggagatggaatggtcggagttgtcaaggcagacctcgagatggagaaaaagtgttatgaga |
127 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||| ||||||||||||||||||||||||||||||||| | || |||| ||||| ||||| || | |
|
|
| T |
6323707 |
gtgatctcaaccctacacctcaccatgaaatatcctgccggagatggaatggtcggagttgtcaaggcagacttggatatggccaaaaattgttaggata |
6323608 |
T |
 |
| Q |
128 |
tgtgccctacggct-----atttaggtgtttctttcaattttca |
166 |
Q |
| |
|
||||||| | |||| ||||||||||||||||| ||||||| |
|
|
| T |
6323607 |
tgtgccccatggctttttaatttaggtgtttctttcgattttca |
6323564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 56 - 109
Target Start/End: Complemental strand, 6327015 - 6326962
Alignment:
| Q |
56 |
aatatcctattggagatggaatggtcggagttgtcaaggcagacctcgagatgg |
109 |
Q |
| |
|
|||||||| |||||||||||| |||||| |||||| |||||||||||||||||| |
|
|
| T |
6327015 |
aatatcctgttggagatggaaaggtcggtgttgtcgaggcagacctcgagatgg |
6326962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 46 - 122
Target Start/End: Complemental strand, 6330015 - 6329939
Alignment:
| Q |
46 |
ctcacaatgaaatatcctattggagatggaatggtcggagttgtcaaggcagacctcgagatggagaaaaagtgtta |
122 |
Q |
| |
|
||||| |||||||||||| |||||||||||| ||| |||||||| | |||||| || ||||||| || |||||||| |
|
|
| T |
6330015 |
ctcaccatgaaatatcctcttggagatggaaaggttggagttgttagggcagatcttgagatggctaagaagtgtta |
6329939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University