View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4503-Insertion-3 (Length: 415)
Name: NF4503-Insertion-3
Description: NF4503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4503-Insertion-3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 2e-93; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 2e-93
Query Start/End: Original strand, 7 - 232
Target Start/End: Original strand, 40410832 - 40411051
Alignment:
| Q |
7 |
aaaagtatgattttttagttgatagcaagacaaaattgttagctggaatcaaagtttggacttcatttttagtactcctttcaacatcatcttgacaata |
106 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
40410832 |
aaaagtatgactttttagttgatagcaagacaaatttgttagctggaatcaaagtttggacttcatttttagtactgat--caacatcatcttgacaata |
40410929 |
T |
|
| Q |
107 |
ttaataatatcagttagctacatatactatctctgacaacggataaaaggtatgatctaacttagaacatatatacttccatatattattgccctcccaa |
206 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40410930 |
ttaataatatcagttagctacatatactacctctgacaacggataaaaggtatgatctaacttagaac----atacttccatatattattgccctcccaa |
40411025 |
T |
|
| Q |
207 |
ctattaaatcattgagatggcaacat |
232 |
Q |
| |
|
|||||||||||| ||||||||||||| |
|
|
| T |
40411026 |
ctattaaatcatagagatggcaacat |
40411051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 332 - 415
Target Start/End: Original strand, 40411527 - 40411607
Alignment:
| Q |
332 |
ataattgcttgccgaatactactgctagtacaaagtgtacaaccttgttacatgatatatataagctgaatacgtacgttgtcc |
415 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
40411527 |
ataattgcttgccgaatactact---agtacaaagtgtacaaccttgttacatgatatatataaactgaatacgtacgttgtcc |
40411607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University