View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4503_low_7 (Length: 302)
Name: NF4503_low_7
Description: NF4503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4503_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 22 - 282
Target Start/End: Complemental strand, 25189001 - 25188741
Alignment:
| Q |
22 |
atagcatacccgatcaaaaggctgccaagagatcacttgatttccaatttggatggtaattacaaaatccattatctagtacaagaaagtcatatatcca |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25189001 |
atagcatacccgatcaaaaggctgccaagagatcacttgatttccaatttggatggtaattacaaaatccattatctagtacaagaaagtcatatatcca |
25188902 |
T |
 |
| Q |
122 |
tcttatttgaaagctattcccccaccaatatttcaaatacaccgattccattcaaatacactatttcggacagagaaaatcatannnnnnngtccattcg |
221 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
25188901 |
tcttatttgaaagctactcccccaccaatatttcaaatacaccgattccattcaaatacactatttcggacagagaaaatcatatttttttgtccattcg |
25188802 |
T |
 |
| Q |
222 |
aaatggctcatttgaattaaaccgttgttttagaaattgtttgaagataactacactttgg |
282 |
Q |
| |
|
|||||| ||||| || || ||| ||||||||||||||| || |||||| ||||||||| |
|
|
| T |
25188801 |
aaatggtgtatttggatgaacccggagttttagaaattgttggaggataacaacactttgg |
25188741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University