View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4503_low_9 (Length: 264)
Name: NF4503_low_9
Description: NF4503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4503_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 21 - 255
Target Start/End: Original strand, 9945950 - 9946184
Alignment:
| Q |
21 |
ttccaccttctccctctccataccaccctacagtcattgtcattgtcatcattgcatttggcggcattgccttgctctccatgcttgcttttgcattatt |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9945950 |
ttccaccttctccctctccataccaccctacagtcattgtcattgtcatcattgcatttggtggcattgccttgctctccatgcttgcttttgcattatt |
9946049 |
T |
|
| Q |
121 |
ttgctgcgttcaaaagaggaagaagaaacaagaaaccgatatcgttcatatcaatgaacataaaaagatcacggaaaatattgtgcctggtcctaatgga |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| || |||||||| |||||||||||||||| |||||||| ||||||||||||||| |||| |
|
|
| T |
9946050 |
ttgctgcgttcaaaagaggaagaagaaacaagaaaccgatgtcattcatatcgatgaacataaaaagattacggaaaacattgtgcctggtccttttgga |
9946149 |
T |
|
| Q |
221 |
caaccactggtggtggttacagttgaagatgatgt |
255 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |
|
|
| T |
9946150 |
caaccaacggtggtggttacagttgaagatgatgt |
9946184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 139 - 224
Target Start/End: Complemental strand, 1022214 - 1022129
Alignment:
| Q |
139 |
gaagaagaaacaagaaaccgatatcgttcatatcaatgaacataaaaagatcacggaaaatattgtgcctggtcctaatggacaac |
224 |
Q |
| |
|
|||||||| |||||||||||||||| | || ||| |||| ||||||||| || ||||| ||||| ||||||||| |||||||| |
|
|
| T |
1022214 |
gaagaagacacaagaaaccgatatcatacacatcgatgagcataaaaagggcaaggaaaccattgtacctggtccttttggacaac |
1022129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University