View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4505-Insertion-5 (Length: 527)
Name: NF4505-Insertion-5
Description: NF4505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4505-Insertion-5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 117; Significance: 2e-59; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 342 - 522
Target Start/End: Original strand, 39507245 - 39507425
Alignment:
| Q |
342 |
tcagctctttgggcactgtgacaacttttctacttgcttgttttggttatcttgtccattgaataaccatttatgttttgtaaattgtttagggctacaa |
441 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||||||||||| |||||||||||| ||||||| ||||| ||||| |||| ||||||||||||| |
|
|
| T |
39507245 |
tcagctcttttggcactgtgacaacttttcaacttgcttgttttgcttatcttgtccactgaataatcatttttgtttctctaattatttagggctacaa |
39507344 |
T |
|
| Q |
442 |
tgttctcaaaagacttgctgatgtgattgataaatctgataagaaaactcttgagcaattaagtgggtaagaaattttagc |
522 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||| |||| ||||||||||| ||||||||||||||||| |
|
|
| T |
39507345 |
tgttctcaaaagacttgctgatgtgattgataagtctgataagaatgctctagagcaattaagcgggtaagaaattttagc |
39507425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 27 - 107
Target Start/End: Original strand, 39505781 - 39505861
Alignment:
| Q |
27 |
ttcagggtacaatgcaaataagttgcccctaggaaaccttagcaaatcaacaatttcgaaggtaagcctttgagcatgtca |
107 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||| || |||||||||||||||| ||||||||||| || |||||||| |
|
|
| T |
39505781 |
ttcagggtacaatgcaaacaagttgccccttggaaaactcagcaaatcaacaattttgaaggtaagccaatgggcatgtca |
39505861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 48; Significance: 3e-18; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 437 - 516
Target Start/End: Original strand, 8880520 - 8880599
Alignment:
| Q |
437 |
tacaatgttctcaaaagacttgctgatgtgattgataaatctgataagaaaactcttgagcaattaagtgggtaagaaat |
516 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||| |||| |||| |||||| ||| |||||||||| |
|
|
| T |
8880520 |
tacaatgttctcaaaagacttgctgatgtgattgataaatttgataggaaagctctagagcaaataatccggtaagaaat |
8880599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University