View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4505_high_8 (Length: 268)
Name: NF4505_high_8
Description: NF4505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4505_high_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 29 - 181
Target Start/End: Original strand, 10229004 - 10229156
Alignment:
| Q |
29 |
tattacattgatgttatgaaaaacaaataatgtttgatgaagatacggcatcaatcaagtggattggtgtctttgatgggcagatcccttcagaatgcag |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
10229004 |
tattacattgatgttatgaaaaacaaataatgtttgatgaagacacggcatcaatcaagtggattggtgtctttgatggacagatcccttcagaatgcag |
10229103 |
T |
|
| Q |
129 |
aaccgcaggcgtcgactgaaggattccaacttctcaaacctgtcaggcttaag |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10229104 |
aaccgcaggcgtcgactgaaggattccaacttctcaaacctgtcaggcttaag |
10229156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University