View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4505_low_6 (Length: 364)
Name: NF4505_low_6
Description: NF4505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4505_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 329; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 329; E-Value: 0
Query Start/End: Original strand, 19 - 351
Target Start/End: Complemental strand, 7044690 - 7044358
Alignment:
| Q |
19 |
aatcggacatctatataaaatttagatttgtttataatgtcggtgtccggttattaaactcaaacgcttctcaaatggagcatagatagcttgtgtttca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7044690 |
aatcggacatctatataaaatttagatttgtttataatgtcggtgtccggttattaaactcaaacgcttctcaaatggagcatagatagcttgtgtttca |
7044591 |
T |
|
| Q |
119 |
agtatgacagctgatgtgttgaatatattgcaaaacagattcttccgattaacatcaaaggccttgccggaagttttgcaacacttgccaattggttctt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7044590 |
agtatgacagctgatgtgttgaatatattgcaaaacagattcttccgattaacatcaaaggccttgccggaagttttgcaacacttgccaattggttctt |
7044491 |
T |
|
| Q |
219 |
ttcgtggttgattacattgacagcaaatttgctcttggattggagttctggaggtttgtgtgcattgtccaagttatatttttctcgaaatatctttgtt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
7044490 |
ttcgtggttgattacattgacagcaaatttgctcttggattggagttctggaggtttgtgtgcattgtccgagttatatttttctcgaaatatctttgtt |
7044391 |
T |
|
| Q |
319 |
atttgttgctaaccagaagcttcttttgttctt |
351 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
7044390 |
atttgttgctaaccagaagcttcttttgttctt |
7044358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University