View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4505_low_9 (Length: 340)
Name: NF4505_low_9
Description: NF4505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4505_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 310; Significance: 1e-174; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 11 - 324
Target Start/End: Original strand, 34628954 - 34629267
Alignment:
| Q |
11 |
cacagacattgttgccccatttgatgcaactactcctttcatatttgaccatgcatattatggtaacttgcagaacaagatggggttgctagcatctgac |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34628954 |
cacagacattgttgccccatttgatgcaactactcctttcatatttgaccatgcatattatggtaacttgcagaacaagatggggttgctagcatctgac |
34629053 |
T |
|
| Q |
111 |
caagctttggctttggatccacgaaccaagtcactggttcaagattttgcaaaggataaacaaaagttttttcaagcttttgcatctgctatggacaaaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34629054 |
caagctttggctttggatccacgaaccaagtcactggttcaagattttgcaaaggataaacaaaagttttttcaagcttttgcatctgctatggacaaaa |
34629153 |
T |
|
| Q |
211 |
tgagtttagtgaaagttttgagaggaaaaaagcatggggagagaaggagagattgtagcatgcatatgtgagaactgagagatactgttcacacaatttt |
310 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34629154 |
tgagtttagtgaaagttgtgagaggaaaaaagcatggggagagaaggagagattgtagcatgcatatgtgagaactgagagatactgttcacacaatttt |
34629253 |
T |
|
| Q |
311 |
tgcatttataactg |
324 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
34629254 |
tgcatttataactg |
34629267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University