View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4506_high_6 (Length: 235)

Name: NF4506_high_6
Description: NF4506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4506_high_6
NF4506_high_6
[»] chr4 (2 HSPs)
chr4 (169-228)||(4694982-4695041)
chr4 (18-79)||(4695121-4695186)


Alignment Details
Target: chr4 (Bit Score: 52; Significance: 6e-21; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 169 - 228
Target Start/End: Complemental strand, 4695041 - 4694982
Alignment:
169 gcaacaatggatcgcacacaaatgcttctggttggtttaccactcttcctattcatctca 228  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||    
4695041 gcaacaatggatcgcacacaaatccttctggttggtttaccactcttcctattcttctca 4694982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 18 - 79
Target Start/End: Complemental strand, 4695186 - 4695121
Alignment:
18 aaaagattaacaaggcaaatagatatcgaacgaaataag----tactcaaatccaaagttattagc 79  Q
    |||||||||||||||||||||||||||||||||||||||    |||||||||||||||||||||||    
4695186 aaaagattaacaaggcaaatagatatcgaacgaaataagtatttactcaaatccaaagttattagc 4695121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University