View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4506_low_6 (Length: 249)
Name: NF4506_low_6
Description: NF4506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4506_low_6 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 17 - 249
Target Start/End: Complemental strand, 2082282 - 2082049
Alignment:
| Q |
17 |
attaattatgcgaatgtgagttgatttttt-ggcttctattaaattaaaggatgaattttgcaaattgttgttgtaatgcaggatgctattaaaactgct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2082282 |
attaattatgcgaatgtgagttgatttttttggcttctattaaattaaaggatgaattttgcaaattgttgttgtaatgcaggatgctattaaaactgct |
2082183 |
T |
 |
| Q |
116 |
cttttacttggggctactgaccctaggattggagggattgctatatcaggaaggcgtggaactgctaaaaccataatggcacgtggaatgcatgcaatac |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2082182 |
cttttacttggggctactgaccctaggattggagggattgctatatcaggaaggcgtggaactgctaaaaccataatggcacgtggaatgcacgcaatac |
2082083 |
T |
 |
| Q |
216 |
ttccgcctattgaagtagtagaaggttccatagc |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
2082082 |
ttccgcctattgaagtagtagaaggttccatagc |
2082049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University