View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4507_low_9 (Length: 239)
Name: NF4507_low_9
Description: NF4507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4507_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 16 - 224
Target Start/End: Complemental strand, 5169159 - 5168952
Alignment:
| Q |
16 |
aaacttttagaatttttcaaataaaacagttcctattttaaaattcagaattttaaccctcttattttcttagcagattgacacatgggttatgtgcttc |
115 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5169159 |
aaacttttagaatttttcaaatacaacagttcctattttaaaattcagaattttaaccctcttattttcttagcagattgacacatgggttatgtgcttc |
5169060 |
T |
 |
| Q |
116 |
atatatttgtgattaactgtcatcagaaagcgataaagtgttgcataatgttaatatgttgcacaatgggataactggacaaggttgtgaagaagatcaa |
215 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5169059 |
atata-ttgtgattaactgtcatcagaaagcgataaagtgttgcataatgttaatatgttgcacaatgggataacttgacaaggttgtgaagaagatcaa |
5168961 |
T |
 |
| Q |
216 |
gataatggt |
224 |
Q |
| |
|
||||||||| |
|
|
| T |
5168960 |
gataatggt |
5168952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University