View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4509-Insertion-8 (Length: 248)
Name: NF4509-Insertion-8
Description: NF4509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4509-Insertion-8 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 7 - 248
Target Start/End: Complemental strand, 6265647 - 6265408
Alignment:
| Q |
7 |
aatatgatataggaggatcaatgtgtcagagaggaggatacaatgcaatgtaccaaatatagnnnnnnngattgcaaagtgaagagatagcgtattaacg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
6265647 |
aatatgatataggaggatcaatgtgtcagagaggaggatacaatgcaatgtaccaaatatagaaaaaaagattgcaaagtgaagagatagcgtattaacg |
6265548 |
T |
 |
| Q |
107 |
catatgcaaagtgcagagtcctcttggttgtttacnnnnnnnncctctcccaaaaatataataattaaaaatctaatcttattgggtatattgggaccct |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6265547 |
catatgcaaagtgcagagtcctcttggttgtttacttttttttc--ctcccaaaaatataataattaaaaatctaatcttattgggtatattgggaccct |
6265450 |
T |
 |
| Q |
207 |
ttttcacatgggccaaattcgctagaaccctctccctccata |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
6265449 |
ttttcacatgggccaaattcgctagaaccctcttcctccata |
6265408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University