View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4509-Insertion-9 (Length: 219)
Name: NF4509-Insertion-9
Description: NF4509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4509-Insertion-9 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 7 - 219
Target Start/End: Original strand, 42747078 - 42747290
Alignment:
| Q |
7 |
aaaccacacacaaacaaaaaacgctatccacaccccttctcccacttttcatttccactaacccacaccaccttaatcctcaccatctccaaaacctctg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42747078 |
aaaccacacacaaacaaaaaacgctatccacaccccttctcccacttttcatttccactaacccacaccaccttaatcctcaccatctccaaaacctctg |
42747177 |
T |
 |
| Q |
107 |
ctccatatgcaaccactcttttcacagatttcccaactttaatatctctgacaaccctgaacaagttgatatcaacaagcttcgcattgctctttctcat |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| ||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42747178 |
ctccatatgcaaccactcttttcacagattccccaaccttaatatctctgacacccctgagcaagttgatatcaacaagcttcgcattgctctttctcat |
42747277 |
T |
 |
| Q |
207 |
agtgatgttcttg |
219 |
Q |
| |
|
||||||||||||| |
|
|
| T |
42747278 |
agtgatgttcttg |
42747290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University