View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4509_low_12 (Length: 234)
Name: NF4509_low_12
Description: NF4509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4509_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 7 - 225
Target Start/End: Original strand, 25011488 - 25011706
Alignment:
| Q |
7 |
aaacacgttgctttgtcaaattatcgtttcgtgtaagtgctatacactattcgaagaattccacaggattgaagagtaagtttgaagagaaattattgaa |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25011488 |
aaacacgttgctttgtcaaattatcgtttcgaaaaagtgctatacactattcgaagaattccacaggattgaagagtaagtttgaagagaaattattgaa |
25011587 |
T |
 |
| Q |
107 |
accgtcaagttgagtactcacagagtgaagaatccctttggttgtaacatcaaatgcacctgcagtaccaccagcagcactgatccagtcaacgatcctc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25011588 |
accgtcaagttgagtactcacagagtgaagaatccctttggttgtaacatcaaatgcacctgcagtaccaccagcagcactgatccagtcaacgatcctc |
25011687 |
T |
 |
| Q |
207 |
tgcctgtgtgcatcttgat |
225 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
25011688 |
tgcctgtgtgcatcttgat |
25011706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University