View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4510_high_5 (Length: 373)
Name: NF4510_high_5
Description: NF4510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4510_high_5 |
 |  |
|
| [»] scaffold0078 (1 HSPs) |
 |  |  |
|
| [»] scaffold0197 (1 HSPs) |
 |  |  |
|
| [»] scaffold0023 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 2e-99; HSPs: 9)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 2e-99
Query Start/End: Original strand, 154 - 357
Target Start/End: Original strand, 45703740 - 45703942
Alignment:
| Q |
154 |
tttctaagaaatcatcaatcataatgagcaaatagaaactattgtcaagatatgttgctattgtcagaccccaaagatttgaacgaacatactcaaaagg |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
45703740 |
tttctaagaaatcatcaatcataatgagcaaatagaaactattgtcaagatatgttgctattgtcagaccccaaag-tttgaacgaacatattcaaaagg |
45703838 |
T |
 |
| Q |
254 |
tctactagaattatgagtgtcacttacttaaatgtatgttgtttctttaatatgcaattatcataaaattctaattcctctaatttaacattccctaaca |
353 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
45703839 |
tctactagaattatgaatgtcacttacttaaatgtatgttgtttctttaatatgcaattatcataaaattccaattcctctaatttaacattccctaaca |
45703938 |
T |
 |
| Q |
354 |
caca |
357 |
Q |
| |
|
|||| |
|
|
| T |
45703939 |
caca |
45703942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 99; E-Value: 9e-49
Query Start/End: Original strand, 1 - 122
Target Start/End: Original strand, 45703613 - 45703739
Alignment:
| Q |
1 |
aaaactcattaaaagatcctaaaacaaa-----cttgaggtcgttgttagttcttaatactttcaatttagtttatgagtgattctctataagaatacat |
95 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |
|
|
| T |
45703613 |
aaaactcattaaaagatcctaaaacaaattaaacttgaggtcgttgttagttcttaatactttcaatttagtttctgagtgattctctataagaatatat |
45703712 |
T |
 |
| Q |
96 |
cattccttaaactttttaaaggtgtca |
122 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
45703713 |
cattccttaaactttttaaaggtgtca |
45703739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 95 - 138
Target Start/End: Original strand, 4860908 - 4860951
Alignment:
| Q |
95 |
tcattccttaaactttttaaaggtgtcacttttatttttcaaaa |
138 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||| |||||||||| |
|
|
| T |
4860908 |
tcattccttaaacttttcaaatgtgtcacttttgtttttcaaaa |
4860951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 95 - 138
Target Start/End: Original strand, 18411834 - 18411877
Alignment:
| Q |
95 |
tcattccttaaactttttaaaggtgtcacttttatttttcaaaa |
138 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||| |||||||||| |
|
|
| T |
18411834 |
tcattccttaaacttttaaaatgtgtcacttttttttttcaaaa |
18411877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 96 - 138
Target Start/End: Original strand, 21644214 - 21644256
Alignment:
| Q |
96 |
cattccttaaactttttaaaggtgtcacttttatttttcaaaa |
138 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| |||||||||| |
|
|
| T |
21644214 |
cattccttaaacttttcaaatgtgtcacttttgtttttcaaaa |
21644256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 220 - 268
Target Start/End: Original strand, 3323139 - 3323187
Alignment:
| Q |
220 |
gaccccaaagatttgaacgaacatactcaaaaggtctactagaattatg |
268 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||| |||||||| ||||| |
|
|
| T |
3323139 |
gaccccaaagatccgaatgaacatactcaaaaggcctactagatttatg |
3323187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 220 - 264
Target Start/End: Original strand, 16883228 - 16883272
Alignment:
| Q |
220 |
gaccccaaagatttgaacgaacatactcaaaaggtctactagaat |
264 |
Q |
| |
|
|||||||||||| ||| | ||||||||||||||||||||||||| |
|
|
| T |
16883228 |
gaccccaaagatccgaatgcacatactcaaaaggtctactagaat |
16883272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 220 - 264
Target Start/End: Complemental strand, 24263109 - 24263065
Alignment:
| Q |
220 |
gaccccaaagatttgaacgaacatactcaaaaggtctactagaat |
264 |
Q |
| |
|
|||||||||||| ||| | ||||||||||||||||||||||||| |
|
|
| T |
24263109 |
gaccccaaagatccgaatgcacatactcaaaaggtctactagaat |
24263065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 220 - 268
Target Start/End: Complemental strand, 25407244 - 25407196
Alignment:
| Q |
220 |
gaccccaaagatttgaacgaacatactcaaaaggtctactagaattatg |
268 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||| |||||||| ||||| |
|
|
| T |
25407244 |
gaccccaaagatccgaatgaacatactcaaaaggcctactagatttatg |
25407196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000009; HSPs: 10)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 101 - 149
Target Start/End: Original strand, 40771336 - 40771384
Alignment:
| Q |
101 |
cttaaactttttaaaggtgtcacttttatttttcaaaatatgaactcat |
149 |
Q |
| |
|
||||||||||| ||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
40771336 |
cttaaacttttcaaatgtgtcacttttatgtttcaaaatatgaactcat |
40771384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 220 - 268
Target Start/End: Original strand, 22624330 - 22624378
Alignment:
| Q |
220 |
gaccccaaagatttgaacgaacatactcaaaaggtctactagaattatg |
268 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||| |||||||| ||||| |
|
|
| T |
22624330 |
gaccccaaagatctgaatgaacatactcaaaaggcctactagatttatg |
22624378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 219 - 268
Target Start/End: Complemental strand, 54190339 - 54190290
Alignment:
| Q |
219 |
agaccccaaagatttgaacgaacatactcaaaaggtctactagaattatg |
268 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||| |||||||| ||||| |
|
|
| T |
54190339 |
agaccccaaagatccgaatgaacatactcaaaaggcctactagatttatg |
54190290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 220 - 264
Target Start/End: Complemental strand, 2674006 - 2673962
Alignment:
| Q |
220 |
gaccccaaagatttgaacgaacatactcaaaaggtctactagaat |
264 |
Q |
| |
|
|||||||||||| ||| | ||||||||||||||||||||||||| |
|
|
| T |
2674006 |
gaccccaaagatccgaatgcacatactcaaaaggtctactagaat |
2673962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 220 - 268
Target Start/End: Complemental strand, 6305141 - 6305093
Alignment:
| Q |
220 |
gaccccaaagatttgaacgaacatactcaaaaggtctactagaattatg |
268 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||| |||||||| ||||| |
|
|
| T |
6305141 |
gaccccaaagatccgaatgaacatactcaaaaggcctactagatttatg |
6305093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 220 - 264
Target Start/End: Original strand, 8515395 - 8515439
Alignment:
| Q |
220 |
gaccccaaagatttgaacgaacatactcaaaaggtctactagaat |
264 |
Q |
| |
|
|||||||||||| ||| | ||||||||||||||||||||||||| |
|
|
| T |
8515395 |
gaccccaaagatccgaatgcacatactcaaaaggtctactagaat |
8515439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 220 - 268
Target Start/End: Original strand, 10097157 - 10097205
Alignment:
| Q |
220 |
gaccccaaagatttgaacgaacatactcaaaaggtctactagaattatg |
268 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||| |||||||| ||||| |
|
|
| T |
10097157 |
gaccccaaagatccgaatgaacatactcaaaaggcctactagatttatg |
10097205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 220 - 268
Target Start/End: Original strand, 10204043 - 10204091
Alignment:
| Q |
220 |
gaccccaaagatttgaacgaacatactcaaaaggtctactagaattatg |
268 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||| |||||||| ||||| |
|
|
| T |
10204043 |
gaccccaaagatccgaatgaacatactcaaaaggcctactagatttatg |
10204091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 220 - 268
Target Start/End: Original strand, 10611128 - 10611176
Alignment:
| Q |
220 |
gaccccaaagatttgaacgaacatactcaaaaggtctactagaattatg |
268 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||| |||||||| ||||| |
|
|
| T |
10611128 |
gaccccaaagatccgaatgaacatactcaaaaggcctactagatttatg |
10611176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 220 - 264
Target Start/End: Original strand, 32478641 - 32478685
Alignment:
| Q |
220 |
gaccccaaagatttgaacgaacatactcaaaaggtctactagaat |
264 |
Q |
| |
|
|||||||||||| ||| | ||||||||||||||||||||||||| |
|
|
| T |
32478641 |
gaccccaaagatccgaatgcacatactcaaaaggtctactagaat |
32478685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000002; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 220 - 264
Target Start/End: Complemental strand, 33332862 - 33332818
Alignment:
| Q |
220 |
gaccccaaagatttgaacgaacatactcaaaaggtctactagaat |
264 |
Q |
| |
|
|||||||||||| |||| | ||||||||||||||||||||||||| |
|
|
| T |
33332862 |
gaccccaaagatctgaatgcacatactcaaaaggtctactagaat |
33332818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 220 - 268
Target Start/End: Original strand, 35204414 - 35204462
Alignment:
| Q |
220 |
gaccccaaagatttgaacgaacatactcaaaaggtctactagaattatg |
268 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
35204414 |
gaccccaaagatccgaatgaacatactcaaaaggtctactagatttatg |
35204462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 220 - 268
Target Start/End: Complemental strand, 13880569 - 13880521
Alignment:
| Q |
220 |
gaccccaaagatttgaacgaacatactcaaaaggtctactagaattatg |
268 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||| |||||||| ||||| |
|
|
| T |
13880569 |
gaccccaaagatccgaatgaacatactcaaaaggcctactagatttatg |
13880521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 220 - 264
Target Start/End: Complemental strand, 14739358 - 14739314
Alignment:
| Q |
220 |
gaccccaaagatttgaacgaacatactcaaaaggtctactagaat |
264 |
Q |
| |
|
|||||||||||| |||| | |||||||||||||| |||||||||| |
|
|
| T |
14739358 |
gaccccaaagatctgaatgcacatactcaaaaggcctactagaat |
14739314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000008; HSPs: 6)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 95 - 138
Target Start/End: Complemental strand, 24557495 - 24557452
Alignment:
| Q |
95 |
tcattccttaaactttttaaaggtgtcacttttatttttcaaaa |
138 |
Q |
| |
|
||||||||||||||| | ||||||||||||||| |||||||||| |
|
|
| T |
24557495 |
tcattccttaaacttctcaaaggtgtcacttttgtttttcaaaa |
24557452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 95 - 138
Target Start/End: Complemental strand, 24598527 - 24598484
Alignment:
| Q |
95 |
tcattccttaaactttttaaaggtgtcacttttatttttcaaaa |
138 |
Q |
| |
|
||||||||||||||| | ||||||||||||||| |||||||||| |
|
|
| T |
24598527 |
tcattccttaaacttctcaaaggtgtcacttttgtttttcaaaa |
24598484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 96 - 138
Target Start/End: Original strand, 27448000 - 27448042
Alignment:
| Q |
96 |
cattccttaaactttttaaaggtgtcacttttatttttcaaaa |
138 |
Q |
| |
|
||||| |||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
27448000 |
cattctttaaacttttcaaaggtgtcacttttgtttttcaaaa |
27448042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 96 - 138
Target Start/End: Original strand, 43595298 - 43595340
Alignment:
| Q |
96 |
cattccttaaactttttaaaggtgtcacttttatttttcaaaa |
138 |
Q |
| |
|
||||| |||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
43595298 |
cattctttaaacttttcaaaggtgtcacttttgtttttcaaaa |
43595340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 96 - 138
Target Start/End: Original strand, 43628092 - 43628134
Alignment:
| Q |
96 |
cattccttaaactttttaaaggtgtcacttttatttttcaaaa |
138 |
Q |
| |
|
||||| |||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
43628092 |
cattctttaaacttttcaaaggtgtcacttttgtttttcaaaa |
43628134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 220 - 264
Target Start/End: Complemental strand, 31398778 - 31398734
Alignment:
| Q |
220 |
gaccccaaagatttgaacgaacatactcaaaaggtctactagaat |
264 |
Q |
| |
|
|||||||||||| ||| | ||||||||||||||||||||||||| |
|
|
| T |
31398778 |
gaccccaaagatccgaatgcacatactcaaaaggtctactagaat |
31398734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 5)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 96 - 138
Target Start/End: Original strand, 26299550 - 26299592
Alignment:
| Q |
96 |
cattccttaaactttttaaaggtgtcacttttatttttcaaaa |
138 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| |||||||||| |
|
|
| T |
26299550 |
cattccttaaacttttcaaatgtgtcacttttgtttttcaaaa |
26299592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 220 - 264
Target Start/End: Complemental strand, 10686050 - 10686006
Alignment:
| Q |
220 |
gaccccaaagatttgaacgaacatactcaaaaggtctactagaat |
264 |
Q |
| |
|
|||||||||||| ||| | ||||||||||||||||||||||||| |
|
|
| T |
10686050 |
gaccccaaagatccgaatgcacatactcaaaaggtctactagaat |
10686006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 220 - 268
Target Start/End: Original strand, 16755611 - 16755659
Alignment:
| Q |
220 |
gaccccaaagatttgaacgaacatactcaaaaggtctactagaattatg |
268 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||| |||||||| ||||| |
|
|
| T |
16755611 |
gaccccaaagatccgaatgaacatactcaaaaggcctactagatttatg |
16755659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 220 - 268
Target Start/End: Complemental strand, 28329725 - 28329677
Alignment:
| Q |
220 |
gaccccaaagatttgaacgaacatactcaaaaggtctactagaattatg |
268 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||| |||||||| ||||| |
|
|
| T |
28329725 |
gaccccaaagatccgaatgaacatactcaaaaggcctactagatttatg |
28329677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 220 - 264
Target Start/End: Original strand, 35743690 - 35743734
Alignment:
| Q |
220 |
gaccccaaagatttgaacgaacatactcaaaaggtctactagaat |
264 |
Q |
| |
|
|||||||||||| ||| | ||||||||||||||||||||||||| |
|
|
| T |
35743690 |
gaccccaaagatccgaatgcacatactcaaaaggtctactagaat |
35743734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 95 - 145
Target Start/End: Complemental strand, 47745914 - 47745865
Alignment:
| Q |
95 |
tcattccttaaactttttaaaggtgtcacttttatttttcaaaatatgaac |
145 |
Q |
| |
|
||||||||||||||||| ||| ||||||| ||||||||||||||| ||||| |
|
|
| T |
47745914 |
tcattccttaaacttttcaaatgtgtcac-tttatttttcaaaatgtgaac |
47745865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000003; HSPs: 6)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 96 - 138
Target Start/End: Original strand, 25394063 - 25394105
Alignment:
| Q |
96 |
cattccttaaactttttaaaggtgtcacttttatttttcaaaa |
138 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| |||||||||| |
|
|
| T |
25394063 |
cattccttaaacttttcaaatgtgtcacttttgtttttcaaaa |
25394105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 220 - 268
Target Start/End: Complemental strand, 2738035 - 2737987
Alignment:
| Q |
220 |
gaccccaaagatttgaacgaacatactcaaaaggtctactagaattatg |
268 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||| |||||||| ||||| |
|
|
| T |
2738035 |
gaccccaaagatccgaatgaacatactcaaaaggcctactagatttatg |
2737987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 220 - 264
Target Start/End: Original strand, 19347579 - 19347623
Alignment:
| Q |
220 |
gaccccaaagatttgaacgaacatactcaaaaggtctactagaat |
264 |
Q |
| |
|
|||||||||||| ||| | ||||||||||||||||||||||||| |
|
|
| T |
19347579 |
gaccccaaagatccgaatgcacatactcaaaaggtctactagaat |
19347623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 220 - 268
Target Start/End: Original strand, 20053111 - 20053159
Alignment:
| Q |
220 |
gaccccaaagatttgaacgaacatactcaaaaggtctactagaattatg |
268 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||| |||||||| ||||| |
|
|
| T |
20053111 |
gaccccaaagatccgaatgaacatactcaaaaggcctactagatttatg |
20053159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 220 - 268
Target Start/End: Complemental strand, 39684078 - 39684030
Alignment:
| Q |
220 |
gaccccaaagatttgaacgaacatactcaaaaggtctactagaattatg |
268 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||| |||||||| ||||| |
|
|
| T |
39684078 |
gaccccaaagatccgaatgaacatactcaaaaggcctactagatttatg |
39684030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 220 - 268
Target Start/End: Complemental strand, 45569220 - 45569172
Alignment:
| Q |
220 |
gaccccaaagatttgaacgaacatactcaaaaggtctactagaattatg |
268 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||| |||||||| ||||| |
|
|
| T |
45569220 |
gaccccaaagatccgaatgaacatactcaaaaggcctactagatttatg |
45569172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000003; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 109 - 155
Target Start/End: Complemental strand, 36295409 - 36295363
Alignment:
| Q |
109 |
ttttaaaggtgtcacttttatttttcaaaatatgaactcattctctt |
155 |
Q |
| |
|
||||||||||||||||||||| ||| ||||| ||||||||| ||||| |
|
|
| T |
36295409 |
ttttaaaggtgtcacttttatgttttaaaatgtgaactcatactctt |
36295363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 220 - 268
Target Start/End: Original strand, 2397574 - 2397622
Alignment:
| Q |
220 |
gaccccaaagatttgaacgaacatactcaaaaggtctactagaattatg |
268 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||| |||||||| ||||| |
|
|
| T |
2397574 |
gaccccaaagatccgaatgaacatactcaaaaggcctactagatttatg |
2397622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 220 - 268
Target Start/End: Complemental strand, 9523558 - 9523510
Alignment:
| Q |
220 |
gaccccaaagatttgaacgaacatactcaaaaggtctactagaattatg |
268 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||| |||||||| ||||| |
|
|
| T |
9523558 |
gaccccaaagatccgaatgaacatactcaaaaggcctactagatttatg |
9523510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0078
Description:
Target: scaffold0078; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 97 - 138
Target Start/End: Original strand, 35188 - 35229
Alignment:
| Q |
97 |
attccttaaactttttaaaggtgtcacttttatttttcaaaa |
138 |
Q |
| |
|
||||||||||||| ||||||||||||||||| ||||| |||| |
|
|
| T |
35188 |
attccttaaacttattaaaggtgtcacttttgttttttaaaa |
35229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0197 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0197
Description:
Target: scaffold0197; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 220 - 264
Target Start/End: Complemental strand, 16095 - 16051
Alignment:
| Q |
220 |
gaccccaaagatttgaacgaacatactcaaaaggtctactagaat |
264 |
Q |
| |
|
|||||||||||| ||| | ||||||||||||||||||||||||| |
|
|
| T |
16095 |
gaccccaaagatccgaatgcacatactcaaaaggtctactagaat |
16051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0023 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0023
Description:
Target: scaffold0023; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 220 - 268
Target Start/End: Original strand, 49557 - 49605
Alignment:
| Q |
220 |
gaccccaaagatttgaacgaacatactcaaaaggtctactagaattatg |
268 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||| |||||||| ||||| |
|
|
| T |
49557 |
gaccccaaagatccgaatgaacatactcaaaaggcctactagatttatg |
49605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University