View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4510_low_12 (Length: 353)
Name: NF4510_low_12
Description: NF4510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4510_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 20 - 234
Target Start/End: Original strand, 42800089 - 42800303
Alignment:
| Q |
20 |
gtatctaacctgatgcaaaatccatacaacaattccagcaaactcaactattccgatgtatctatcaatccaagtagcatcttcaggtgcatcaacatcc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42800089 |
gtatctaacctgatgcaaaatccatacaacaattccagcaaactcaactattccgatgtatctatcaatccaagtagcatcttcaggtgcatcaacatcc |
42800188 |
T |
|
| Q |
120 |
acaacaggtgcactcagaatattgtgacgtgctagtattttcacagcttcagccaaggtagcatctgattttatttcaatttctatacaagcaaacataa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42800189 |
acaacaggtgcactcagaatattgtgacgtgctagtattttcacagcttcagccaaggtagcatctgattttatttcaatttctatacaagcaaacataa |
42800288 |
T |
|
| Q |
220 |
aattcacacttttag |
234 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
42800289 |
aattcacacttttag |
42800303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 306 - 353
Target Start/End: Original strand, 42800377 - 42800424
Alignment:
| Q |
306 |
tgcatgtttggtaccatagttggttggtttgtcagaatcacggtgaac |
353 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42800377 |
tgcatgtttggtaccatagttggttggtttgtcagaatcacggtgaac |
42800424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University