View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4510_low_16 (Length: 311)
Name: NF4510_low_16
Description: NF4510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4510_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 5e-90; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 1 - 176
Target Start/End: Complemental strand, 4844514 - 4844339
Alignment:
| Q |
1 |
tttgacaatttgatttgagtcttttattattgaatttgctttattaggtgatgtacatttttatgggtccagctaagtacaacaacaactttatgtttgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4844514 |
tttgacaatttgatttgagtcttttattattgaatttgctttattaggtgatgtacatttttatgggtccagctaagtacaacaacgactttatgtttgg |
4844415 |
T |
 |
| Q |
101 |
caataatgcataaggttgtggtactattattatcttgtttagtttagatgtatctttgtatttctcgaagtgttta |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4844414 |
caataatgcataaggttgtggtactattattatcttgtttagtttagatgtatctttgtatttctcaaagtgttta |
4844339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 220 - 293
Target Start/End: Complemental strand, 4844342 - 4844269
Alignment:
| Q |
220 |
tttatgcgaaggcaaaaatattgaagtacaccactcatcctcaatcagaaagatcaaaaggtgatgtcgtaaat |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4844342 |
tttatgcgaaggcaaaaatattgaagtacaccactcatcctcaatcagaaagatcaaaaggtgatgtcgtaaat |
4844269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University