View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4510_low_28 (Length: 227)
Name: NF4510_low_28
Description: NF4510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4510_low_28 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 7 - 227
Target Start/End: Original strand, 3705552 - 3705772
Alignment:
| Q |
7 |
acactaatgcttgaccataatgccactgaactgtcaccatgttcccccactatgtatgcctacaatatcaacttacactgataaaatattgagtttacta |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3705552 |
acactaatgcttgaccataatgccactgaactatcaccatgttcccccactatgtatgcctacaatatcaacttaaactgataaaatattgagtttacta |
3705651 |
T |
|
| Q |
107 |
tttgttgatcgtgaccagtgttagttctaaattgcgttctgcaattgctcttgcattgcatgtttggtattatagtgagtttgctaaaatcacggctgcg |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3705652 |
tttgttgatcgtgaccagtgttagttctaaattgcattctgcaattgctcttgcattgcatgtttggtattatagtgagtttgctaaaatcacggctgcg |
3705751 |
T |
|
| Q |
207 |
attttggaaaaactattcact |
227 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
3705752 |
attttggaaaaactattcact |
3705772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 163 - 199
Target Start/End: Original strand, 44980051 - 44980087
Alignment:
| Q |
163 |
tgcatgtttggtattatagtgagtttgctaaaatcac |
199 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
44980051 |
tgcatgtttggaattatagtgagtttgataaaatcac |
44980087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University