View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4510_low_29 (Length: 217)
Name: NF4510_low_29
Description: NF4510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4510_low_29 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 65; Significance: 9e-29; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 18 - 90
Target Start/End: Complemental strand, 40758386 - 40758314
Alignment:
| Q |
18 |
tatacattattctttcggtataaataacatcagcataacagttctttcaacatcaataatatcacaatgctta |
90 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40758386 |
tatacattattctttcagtataaataacatcagcataacaattctttcaacatcaataatatcacaatgctta |
40758314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 142 - 204
Target Start/End: Complemental strand, 40758262 - 40758200
Alignment:
| Q |
142 |
ggcagtggtttgatcatttatctcatgtctgatgtctctctgattcatattgtattcatgatg |
204 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
40758262 |
ggcagtggtttgatcattcatctcatgtctgatgtctctatgattcatattatattcatgatg |
40758200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University