View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4510_low_9 (Length: 375)
Name: NF4510_low_9
Description: NF4510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4510_low_9 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 95; Significance: 2e-46; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 261 - 375
Target Start/End: Complemental strand, 24410431 - 24410317
Alignment:
| Q |
261 |
ttaagcaataccgaagaacaccggttatcatgacctagatgatagaagttaatctgagttcttaactctattttagtgtgccttacaattacaatgatgc |
360 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24410431 |
ttaagcaataccgaagaacactgattatcatgacctagatgatagaagctaatctgagtttttaactctattttagtgtgccttacaattacaatgatgc |
24410332 |
T |
 |
| Q |
361 |
atatgataaaacctc |
375 |
Q |
| |
|
|||||||| |||||| |
|
|
| T |
24410331 |
atatgatataacctc |
24410317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 17 - 106
Target Start/End: Complemental strand, 24410685 - 24410594
Alignment:
| Q |
17 |
ataaagtactaaagcaggttggtcctggtcctgaaacatggaccannnnnnnaattctagtgataaac--tattcaagcctatattatttca |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
24410685 |
ataaagtactaaagcaggttggtcctggtcctgaaacatggaccattttattaattctagtgataaactatattcaagcctatattacttca |
24410594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University