View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4511_low_18 (Length: 232)
Name: NF4511_low_18
Description: NF4511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4511_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 15377101 - 15376875
Alignment:
| Q |
1 |
tgacgataagatactggaggtttcctcggcgcataagaggtcggagtcggtgaaaaagttggagtatgaaatcgacatcgaga-------agattcattc |
93 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
15377101 |
tgacgataagatgctggaggtttcctcgccgcataagaggtcggagtcggtgaagaagttggagtatgaaatcgacatcgggagtggatgagattcattc |
15377002 |
T |
 |
| Q |
94 |
tgttgttgtcatggttttgggatgatcggagaaatcgccggaggttgatcggagaagtcgccgccggagtggatagcgttgatggtggtgagagtgtgaa |
193 |
Q |
| |
|
| |||| ||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
15377001 |
cggtgttatcatggttttgggatgatcggagaagtcgccggaggttgatcggagaagttgccgccggagaggatagcgttgatggtggtgagagtgtgaa |
15376902 |
T |
 |
| Q |
194 |
gtgggagagagtgtgggttgttgatga |
220 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
15376901 |
gtgggagagagtgtgggttgttgatga |
15376875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University