View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4512-Insertion-5 (Length: 218)
Name: NF4512-Insertion-5
Description: NF4512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4512-Insertion-5 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 8 - 218
Target Start/End: Original strand, 28099548 - 28099758
Alignment:
| Q |
8 |
tgatatagaggtattgcattgtacatatatcaattcaagtatatacgaactcgttaagatttgattttatgaatgtgtactttgtttatttacttaaacc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28099548 |
tgatatagaggtattgcattgtacatatatcaattcaagtatatacgaactcgttaagatttgattttatgaatgtgtactttgtttatttacttaaacc |
28099647 |
T |
|
| Q |
108 |
aagttttaagtactctcatcatagaaaatattcaatctagaatctaacttgtttaagactttttctaaataaattctttgaatcttgaacgtgccctttt |
207 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
28099648 |
aagttttaagtactctcataatagaaaatattcaatctagaatctaacttgtttaagactttttctaaataaattctttgaatcttgaacatgccctttt |
28099747 |
T |
|
| Q |
208 |
ctttttctctc |
218 |
Q |
| |
|
||||||||||| |
|
|
| T |
28099748 |
ctttttctctc |
28099758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University