View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4512-Insertion-6 (Length: 173)
Name: NF4512-Insertion-6
Description: NF4512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4512-Insertion-6 |
 |  |
|
| [»] chr8 (8 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 1e-89; HSPs: 8)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 7 - 173
Target Start/End: Complemental strand, 28563171 - 28563005
Alignment:
| Q |
7 |
agtttccacttaatttccaaaaatagaaacactatcttgccgacgattttgactcacataaactttgttagagagatgagagaaattggtgcaagatgcc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28563171 |
agtttccacttaatttccaaaaatagaaacactatcttgccgacgattttgactcacataaactttgttagagagatgagagaaattggtgcaagatgcc |
28563072 |
T |
 |
| Q |
107 |
aaatttctcttgtttgattgtgaagaagttggcgagagaggctgctttaatatgggacctattgtca |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28563071 |
aaatttctcttgtttgattgtgaagaagttggcgagagaggctgctttaatatgggacctattgtca |
28563005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 60; E-Value: 7e-26
Query Start/End: Original strand, 7 - 162
Target Start/End: Complemental strand, 28541383 - 28541211
Alignment:
| Q |
7 |
agtttccacttaatttccaaaaatagaaacactatcttgccgacgattttgactcacataaactttgtt---------------agagagatgagagaa- |
90 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||| |||||||||||| |||||| ||||| ||||||||||||||| |
|
|
| T |
28541383 |
agtttccacttaatttccaaaaatagaaacacaatcttgccgatgattttgactcatataaaccttgttagacttttcagtgaaagagagatgagagaat |
28541284 |
T |
 |
| Q |
91 |
-attggtgcaagatgccaaatttctcttgtttgattgtgaagaagttggcgagagaggctgctttaatatggg |
162 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| ||||||| | ||| |||||||||| ||||| |
|
|
| T |
28541283 |
tattggcaagagatgccaaatttctcttgtttgattgtgaaggagttggcaaaagatgctgctttaacatggg |
28541211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 57; E-Value: 4e-24
Query Start/End: Original strand, 98 - 162
Target Start/End: Complemental strand, 28568580 - 28568516
Alignment:
| Q |
98 |
caagatgccaaatttctcttgtttgattgtgaagaagttggcgagagaggctgctttaatatggg |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
28568580 |
caagatgccaaatttctcttgtttgattgtgaagaagttggcgagagaggttgctttaacatggg |
28568516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 57; E-Value: 4e-24
Query Start/End: Original strand, 98 - 162
Target Start/End: Complemental strand, 28576173 - 28576109
Alignment:
| Q |
98 |
caagatgccaaatttctcttgtttgattgtgaagaagttggcgagagaggctgctttaatatggg |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
28576173 |
caagatgccaaatttctcttgtttgattgtgaagaagttggcgagagaggttgctttaacatggg |
28576109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 47; E-Value: 4e-18
Query Start/End: Original strand, 100 - 173
Target Start/End: Complemental strand, 28557888 - 28557814
Alignment:
| Q |
100 |
agatgccaaatttctcttgtttgattgtgaagaagttggcgagagaggctgcttt-aatatgggacctattgtca |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| ||||| |||||||| || ||||||||||| |||| |
|
|
| T |
28557888 |
agatgccaaatttctcttgtttgattgtgaaggagttggcaagagatgctgctttaaacatgggacctatcgtca |
28557814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 21 - 61
Target Start/End: Complemental strand, 28557979 - 28557939
Alignment:
| Q |
21 |
ttccaaaaatagaaacactatcttgccgacgattttgactc |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28557979 |
ttccaaaaatagaaacactatcttgccgacgattttgactc |
28557939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 9 - 78
Target Start/End: Complemental strand, 28568689 - 28568621
Alignment:
| Q |
9 |
tttccacttaatttccaaaaatagaaacactatcttgccgacgattttgactcacataaactttgttaga |
78 |
Q |
| |
|
||||||||||| |||| || | ||||| ||||||||| ||||||||||||| ||||||||| |||||||| |
|
|
| T |
28568689 |
tttccacttaacttcccaaca-agaaaaactatcttgtcgacgattttgacccacataaaccttgttaga |
28568621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 9 - 78
Target Start/End: Complemental strand, 28576282 - 28576214
Alignment:
| Q |
9 |
tttccacttaatttccaaaaatagaaacactatcttgccgacgattttgactcacataaactttgttaga |
78 |
Q |
| |
|
||||||||||| |||| || | ||||| ||||||||| ||||||||||||| ||||||||| |||||||| |
|
|
| T |
28576282 |
tttccacttaacttcccaaca-agaaaaactatcttgtcgacgattttgacccacataaaccttgttaga |
28576214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University