View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4512_high_14 (Length: 362)
Name: NF4512_high_14
Description: NF4512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4512_high_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 90 - 341
Target Start/End: Original strand, 43062205 - 43062456
Alignment:
| Q |
90 |
gaaatacgtagtaacacactggtatcagagctcccaaaagatcataggagtcatgcaaccttccatattgctttgatatgttgatctgttttttcataaa |
189 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43062205 |
gaaatacgtagcaacacactggtatcagagctcccaaaagatcataggagtcatgcaaccttccatattgctttgatatgttgatctgttttttcataaa |
43062304 |
T |
|
| Q |
190 |
atctagttccgatttccaatgttttttgtcactgattcgtattactgacctctgtattgcataatgttgtcttaacttctttacgttacaatctgctatt |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43062305 |
atctagttccgatttccaatgttttttgtcactgattcgtattattgacctctgtattgcataatgttgtcttaacttctttacgttacaatctgctatt |
43062404 |
T |
|
| Q |
290 |
tggtttctgtattcgggcataggttattaactatcaaaattatgctaggaaa |
341 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43062405 |
tggtttctgtattcgggcataggttattaactatcaaaattttgctaggaaa |
43062456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University