View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4512_high_31 (Length: 277)
Name: NF4512_high_31
Description: NF4512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4512_high_31 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 52 - 257
Target Start/End: Complemental strand, 26050156 - 26049950
Alignment:
| Q |
52 |
aaaaataatagaaatattcaagtcaatgtacaagctattgtgcagcattcaaatctaccatacatcaaaagatttgcatgagaaatatccaccaatttat |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
26050156 |
aaaaataatagaaatattcaagtcaatgtacaagctattgtgcagcattcaaatctaccatacatcaaacgatttgcatgagaaatatccatcaatttat |
26050057 |
T |
|
| Q |
152 |
cagcacgggtttgaattctccctggttgtc-gaatatagaatcagaacccaccaatgcagcaaaagtcatgtcaagtgttaaaaccagaagattcaaatc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
26050056 |
cagcacgggtttgaattctccctggttgtcggaatataggatcagaacccaccaatgcagcaaaagtcatgtccagtgttaaaaccagaagattcaaatc |
26049957 |
T |
|
| Q |
251 |
catatca |
257 |
Q |
| |
|
||||||| |
|
|
| T |
26049956 |
catatca |
26049950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University