View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4512_high_47 (Length: 217)
Name: NF4512_high_47
Description: NF4512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4512_high_47 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 53 - 199
Target Start/End: Complemental strand, 53805357 - 53805211
Alignment:
| Q |
53 |
gttaacggtcacgtgactcagaaaagtgagtgtgttaaatctaacggagttaacgtgagtgagacagaaaacggagaagggaaaaataaggaagctaatt |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53805357 |
gttaacggtcacgtgactcagaaaagtgagtgtgttaaatctaacggagttaacgtgagtgagacagaaaacggagaagggaaaaataaggaagctaatt |
53805258 |
T |
|
| Q |
153 |
taaaagaagagagttcaattttggagaaaaagttaccggagttagaa |
199 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53805257 |
tgaaagaagagagttcaattttggagaaaaagttaccggagttagaa |
53805211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University