View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4512_low_12 (Length: 436)
Name: NF4512_low_12
Description: NF4512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4512_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 351; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 351; E-Value: 0
Query Start/End: Original strand, 16 - 420
Target Start/End: Complemental strand, 29945896 - 29945490
Alignment:
| Q |
16 |
gcatagggtggaaaaagtaatagtctacttttgaagggatgggccttaagattttcgtggttataccccggtacggtttaggtccaaacatggatttagt |
115 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
29945896 |
gcatagggtgggaaaagtaatagtctacttttgaagggatgggccttaagattttcgtggttataccccggtacggtttaggtccaaacatgtatttagt |
29945797 |
T |
|
| Q |
116 |
ttagggtttaggattatagctagtttgcaatattaggcagattgacttctttatacactcact-attc-tttttcattcttcaataatcataatatattt |
213 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||| ||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
29945796 |
ttagggtttaggattatagccagtttgcaatattaagcaaattgacttctttatacactcactgattcatttttcattcttcaataatcataatatattt |
29945697 |
T |
|
| Q |
214 |
gaagtataaatggtactctaacccatggtacaaaaacaatcaaatcaaaaagattgcaaccacccaatagaattttaccaccctttagaaaatttcaaac |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
29945696 |
gaagtataaatggtactctaacccatggtacaaaaacaatcaaatcaaaaagattgcaaccacccaataggatttcaccaccctttagaaaatttcaaac |
29945597 |
T |
|
| Q |
314 |
ctgaatttttctccgcccgatttataaaccaccccaagaagttttaattgcgagatgacgctgatgggatcaactgtttctcctttaaagatgattacgt |
413 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29945596 |
ctgaatttttctccgcccgatttataaaccaccccaagaagttttattttggagatgacgctgatgggatcaactgtttctcctttaaagatgattacgt |
29945497 |
T |
|
| Q |
414 |
ttcttgc |
420 |
Q |
| |
|
||||||| |
|
|
| T |
29945496 |
ttcttgc |
29945490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University